Recherchez sur tout Techno-Science.net
       
Techno-Science.net : Suivez l'actualité des sciences et des technologies, découvrez, commentez
Posté par Isabelle le Vendredi 02/02/2018 à 12:00
La lumière ultraviolette de basse énergie altère les télomères de l'ADN
Identification d'un nouveau mécanisme d'endommagement de l'ADN de nos cellules par du rayonnement UV de basse énergie.

Les télomères*, régions de l'ADN situées sur les extrémités des chromosomes, jouent un rôle important dans la division (La division est une loi de composition qui à deux nombres associe le produit du premier par l'inverse du second. Si un nombre est non nul, la fonction "division par ce nombre" est la réciproque de la...) cellulaire, la cancérogénèse et le vieillissement (La notion de vieillissement décrit une ou plusieurs modifications fonctionnelles diminuant progressivement l'aptitude d'un objet, d'une information ou d'un organisme à assurer ses fonctions.). Leur fonction biologique peut être perturbée par des dommages oxydatifs, que l' on pensait uniquement provoqués par l'interaction (Une interaction est un échange d'information, d'affects ou d'énergie entre deux agents au sein d'un système. C'est une action réciproque qui suppose l'entrée en contact de sujets.) de l'ADN avec d'autres molécules (issues du métabolisme (Le métabolisme est l'ensemble des transformations moléculaires et énergétiques qui se déroulent de manière ininterrompue dans la...) ou reliées à la pollution (La pollution est définie comme ce qui rend un milieu malsain. La définition varie selon le contexte, selon le milieu considéré et selon ce que l'on peut entendre par malsain [1].) et la prise des médicaments) agissant comme oxydants.

Dans le cadre du projet (Un projet est un engagement irréversible de résultat incertain, non reproductible a priori à l’identique, nécessitant le concours et...) ANR OPHID coordonnée par le LIDYL, et d'une Chaire d'Alembert (IDEX ? Univ. Paris-Saclay) attribuée à R. Improta (accueilli au LIDYL), il est montré que la lumière (La lumière est l'ensemble des ondes électromagnétiques visibles par l'œil humain, c'est-à-dire comprises dans des longueurs d'onde de 380nm (violet) à 780nm (rouge). La lumière est intimement liée...) ultraviolette de basse énergie (Dans le sens commun l'énergie désigne tout ce qui permet d'effectuer un travail, fabriquer de la chaleur, de la lumière, de produire un mouvement.), absorbée directement par de l'ADN télomérique, génére des radicaux conduisant à des dommages oxydatifs [1].

La perte d'un électron (L'électron est une particule élémentaire de la famille des leptons, et possèdant une charge électrique élémentaire de signe négatif. C'est un des...) sur l'une des bases d'une chaine ADN génère des radicaux à l'origine de dommages qualifiés "d'oxydatifs". Un tel effet se produit typiquement par des réactions d'oxydoréduction, mais aussi suite à l'absorption ( En optique, l'absorption se réfère au processus par lequel l'énergie d'un photon est prise par une autre entité, par exemple, un atome qui fait une transition...) d'un photon (En physique des particules, le photon est la particule élémentaire médiatrice de l'interaction électromagnétique. Autrement dit, lorsque deux particules chargées électriquement interagissent, cette...) ionisant, pourvu que son énergie soit supérieure au potentiel d'ionisation (L'ionisation est l'action qui consiste à enlever ou ajouter des charges à un atome ou une molécule. L'atome - ou la molécule - en perdant ou en gagnant des charges n'est plus neutre...) des bases, qui constituent l'alphabet du code génétique (Le code génétique désigne le système de correspondance mis en jeu lors de la transformation de l'information génétique des gènes en protéines, au...): ? < 200 nm, E > 6 eV: photons UV et au-delà. Une étude récente montre que ce seuil doit être considérablement abaissé, puisqu'elle met en évidence la formation d'un marqueur (8-oxo-guanine) bien connu des dommages oxydatifs, suite à l'irradiation (En physique nucléaire, l'irradiation désigne l'action d'exposer (volontairement ou accidentellement) un organisme, une substance, d'un corps à un flux de rayonnements ionisants : rayons alpha, bêta, gamma, protons ou...) de l'ADN génomique (La génomique est une discipline de la biologie moderne. Elle étudie le fonctionnement d'un organisme, d'un organe, d'un cancer, etc. à l'échelle du génome, et non plus limitée à celle d'un seul...) à 295 nm. Cette longueur (La longueur d’un objet est la distance entre ses deux extrémités les plus éloignées. Lorsque l’objet est filiforme ou en forme de lacet,...) d'onde (Une onde est la propagation d'une perturbation produisant sur son passage une variation réversible des propriétés physiques locales. Elle transporte de l'énergie sans transporter de matière. Une onde transporte...) correspond à une énergie de 4.2 eV, dans la gamme du rayonnement (Le rayonnement, synonyme de radiation en physique, désigne le processus d'émission ou de transmission d'énergie impliquant une particule porteuse.) UVB du Soleil (Le Soleil (Sol en latin, Helios ou Ήλιος en grec) est l'étoile centrale du système solaire. Dans la classification astronomique, c'est une...) qui arrive sur la surface (Une surface désigne généralement la couche superficielle d'un objet. Le terme a plusieurs acceptions, parfois objet géométrique, parfois...) de la Terre (La Terre est la troisième planète du Système solaire par ordre de distance croissante au Soleil, et la quatrième par taille et par masse croissantes. C'est la plus grande et la plus massive des quatre planètes telluriques,...). (soit 4.2 eV, dans la gamme du rayonnement UVB du Soleil qui arrive sur la surface de la Terre). Le mécanisme associé implique des radicaux cationiques [2].

Afin de mieux comprendre les dommages oxydatifs provoqués par le rayonnement UV sur les télomères de l'ADN, les chercheurs du LIDYL et leurs collaborateurs ont entrepris une étude quantitative des électrons émis et des radicaux formés lors de l'irradiation. Pour ceci, ils ont utilisé la spectroscopie d'absorption résolue en temps (Le temps est un concept développé par l'être humain pour appréhender le changement dans le monde.), couplée à des calculs de chimie quantique (La chimie quantique est l'application de la mécanique quantique aux problèmes de la chimie.). La séquence télomérique humaine, capable de se replier en formant (Dans l'intonation, les changements de fréquence fondamentale sont perçus comme des variations de hauteur : plus la fréquence est élevée, plus la hauteur perçue est haute et...) des structures à quatre brins appelées G-quadruplexes, a été plus particulièrement étudiée. Le rendement quantique observé pour l'ionisation à un photon (En physique des particules, le photon est la particule élémentaire médiatrice de l'interaction électromagnétique. Autrement dit, lorsque deux particules chargées électriquement interagissent, cette interaction se traduit d'un point...) à 266 nm est de 4.5x10-3, comparable à celui d'autres phototoréactions, telles que la dimérisation des bases, bien connues comme source d'endommagement de l'ADN dans ces conditions.


Terminaison G-quadruplex d'une hélice ADN humaine, formée par la séquence télomérique GGGTTAGGGTTAGGGTTAGGG ; les guanines (G) s'associent entre elles par des liaisons hydrogènes en formant des tétrades (b). Après photo-ionisation, la perte d'un proton (Le proton est une particule subatomique portant une charge électrique élémentaire positive.) (bleu ou vert) conduit à la formation de deux radicaux déprotonés différents.

Suite à l'éjection d'électron, les radicaux cations formés peuvent directement réagir ou simplement perdre un proton avant de subir d'autres réactions chimiques. D'un point (Graphie) de vue (La vue est le sens qui permet d'observer et d'analyser l'environnement par la réception et l'interprétation des rayonnements lumineux.) cinétique (Le mot cinétique fait référence à la vitesse.), le proton externe (en vert (Le vert est une couleur complémentaire correspondant à la lumière qui a une longueur d'onde comprise entre 490 et 570 nm. L'œil humain possède un récepteur, appelé cône M, dont la bande passante est...) sur la figure), n'étant pas engagé dans des liaisons hydrogènes, peut être perdu en premier, en moins de 2µs. Curieusement, ce n'est qu'après 5 ms que l'on peut observer le radical ayant perdu le proton interne (En France, ce nom désigne un médecin, un pharmacien ou un chirurgien-dentiste, à la fois en activité et en formation à l'hôpital ou en cabinet pendant une durée variable selon le "Diplôme...) (en bleu) dans le G-quadruplex.

Plusieurs conclusions importantes ont été tirées de ce travail:

La structure secondaire joue (La joue est la partie du visage qui recouvre la cavité buccale, fermée par les mâchoires. On appelle aussi joue le muscle qui sert principalement à ouvrir et...) un rôle clé pour le phénomène de photo-ionisation qui est détecté uniquement pour des G-quadruplexes et non pas pour la séquence télomérique en simple brin.
Trois types de radicaux formés ont été identifiés (le radical cation et deux radicaux externe et interne déprotonés, ayant perdu le proton externe ou le proton interne) ; les réactions chimiques correspondantes restent à découvrir.
Des radicaux cations, qui constituent les porteurs des charges (électrons-trous), survivent dans les G-quadruplexes 1000 fois plus longtemps qu'au sein (Le sein (du latin sinus, « courbure, sinuosité, pli ») ou la poitrine dans son ensemble, constitue la région ventrale supérieure du torse d'un animal, et en particulier...) des simples et doubles hélices d'ADN [3], [4], ce point peut s'avérer utile pour élaborerdes dispositifs nanotechnologiques bio-inspirés.

Note:
*Télomère: région hautement répétitive, donc a priori non codante, d'ADN présente à l'extrémité des chromosomes.



Références:

[1] "Absorption of Low-Energy UV Radiation (Le rayonnement est un transfert d'énergie sous forme d'ondes ou de particules, qui peut se produire par rayonnement électromagnétique (par exemple :...) by Human Telomere G-Quadruplexes Generates Long-Lived Guanine Radical Cations"
A. Banyasz, L. Martinez-Fernandez, C. Balty, M. Perron, T. Douki,R. Improta and D. Markovitsi J. Am. Chem. Soc. 139 2017, 10561.

[2] "Direct oxidative damage of naked DNA generated upon absorption of UV radiation by nucleobases"
M. Gomez-Mendoza, A. Banyasz, T. Douki, D. Markovitsi, and J. L. Ravanat J Phys. Chem. Lett. 7, 2016, 3945.

[3] ?UV-induced adenine radicals induced in DNA A-tracts: spectral and dynamical characterization?
A. Banyasz, T. Ketola, A. Muñoz-Losa, S. Rishi, A. Adhikary, M. D. Sevilla, L. Martinez-Fernandez, R. Improrta and D. Markovitsi J. Phys. Chem. Lett. 7 (2016) 3949.

[4] "Adenine radicals generated in alternating AT duplexes by direct absorption of low-energy UV radiation?
A. Banyasz, T. Ketola, L. Martínez-Fernández, I. Improta and D. Markovitsi Faraday Discussions 7, 2017.

Commentez et débattez de cette actualité sur notre forum Techno-Science.net. Vous pouvez également partager cette actualité sur Facebook, Twitter et les autres réseaux sociaux.
Icone partage sur Facebook Icone partage sur Twitter Partager sur Messenger Icone partage sur Delicious Icone partage sur Myspace Flux RSS
Source et illustration: CEA-IRAMIS