Test de paternité
Source: Wikipédia sous licence CC-BY-SA 3.0.
La liste des auteurs de cet article est disponible ici.

Introduction

Un Test de paternité est une pratique scientifique basée sur l'analyse de l'ADN de deux personnes faite dans le but d'établir un lien de parenté génétique et, partant de là, éventuellement juridique.

Si, en règle générale, l'identité de la mère d'un enfant ne pose pas de problèmes, celle du père peut être davantage sujette à controverses. Comment déterminer, parmi plusieurs hommes, lequel est le vrai père de l'enfant, ou comment apporter la preuve que tel homme (Un homme est un individu de sexe masculin adulte de l'espèce appelée Homme moderne (Homo sapiens) ou plus simplement « Homme ». Par...) est bien le père de l'enfant alors qu'il le nie ?

La science (La science (latin scientia, « connaissance ») est, d'après le dictionnaire Le Robert, « Ce que l'on sait pour l'avoir...) permet d'apporter des réponses à ces questions de filiation et, bien que dits de paternité, ces tests ADN permettent également d'établir le lien mère-enfant.

En France, cette pratique est strictement encadrée sur le plan légal.

Aspects scientifiques

Si différentes méthodes permettaient d'apporter un début de réponse aux questions de filiation, c'est la génétique (La génétique (du grec genno γεννώ = donner naissance) est la science qui étudie l'hérédité et les gènes.) qui permettra d'apporter des réponses les plus complètes et les plus fiables.

Méthodes simples

Des tests assez simples ne requérant aucune analyse poussée (En aérodynamique, la poussée est la force exercée par le déplacement de l'air brassé par un moteur, dans le sens inverse de l'avancement.) peuvent donner de premières conclusions. Cependant, ils ne permettent jamais de confirmer un lien de parenté, ils ne peuvent qu'exclure certaines hypothèses.

Rappels des principes de l'hérédité (L’hérédité (du latin hereditas, « ce dont on hérite ») est la transmission de caractéristiques d'une génération à la suivante, quel que soit le mode de...)

Voici quelques rappels d'hérédité et de génétique car même les méthodes simples décrites ci-dessous trouvent leur fondement dans les gènes.

Un caractère physique (La physique (du grec φυσις, la nature) est étymologiquement la « science de la nature ». Dans un sens...) (couleur de cheveux, taille, etc.) est la traduction de l'information génétique. Pour chacun de ces caractères, il existe deux informations différentes : l'une venue de la mère, l'autre venue du père. Celles-ci peuvent être contradictoires (yeux bleus vs. yeux marron) ou identiques (yeux marron et yeux marron).

Quelques règles permettent de déterminer d'après les deux copies du gène (Un gène est une séquence d'acide désoxyribonucléique (ADN) qui spécifie la synthèse d'une chaîne de polypeptide ou...) quel sera l'aspect de l'individu :

  • Si le gène s'exprime à travers des copies (allèles) codominantes, l'aspect physique correspondra à la moyenne (La moyenne est une mesure statistique caractérisant les éléments d'un ensemble de quantités : elle exprime la grandeur qu'auraient chacun des membres de l'ensemble s'ils étaient tous identiques sans...) des deux informations. Ainsi un enfant qui aura reçu un gène 'Grande taille' et un gène 'Petite taille' sera de taille moyenne.
  • Si le gène s'exprime par contre à travers des allèles dominants et récessifs, l'aspect physique correspondra au gène dominant si l'individu (Le Wiktionnaire est un projet de dictionnaire libre et gratuit similaire à Wikipédia (tous deux sont soutenus par la fondation Wikimedia).) en possède un. Le caractère physique récessif n'apparaîtra que si la personne a reçu l'allèle récessif correspondant de son père ET de sa mère.

Lorsque cet individu aura des enfants, il transmettra soit l'allèle de son père, soit celui de sa mère.

Méthode des gènes récessifs

En étudiant les caractères exprimés par des gènes récessifs, il est possible d'écarter certaines parentés. Ainsi, si un bébé (L'onomatopée bébé désigne l'être humain en bas-âge. En puériculture on distingue plutôt le nouveau-né (le premier mois), le nourrisson (d'un mois à deux ans)...) a les yeux marron mais que sa mère a les yeux bleus, il est exclu que le père de cet enfant ait également les yeux bleus.

En effet, comme l'allèle 'yeux bleus' (codant le gène 'couleur (La couleur est la perception subjective qu'a l'œil d'une ou plusieurs fréquences d'ondes lumineuses, avec une (ou des) amplitude(s) donnée(s).) des yeux') est récessif et que l'allèle 'yeux marron' est dominant, un individu ne peut avoir les yeux bleus que si ses deux allèles du gène responsable de la couleur des yeux indiquent le bleu (Bleu (de l'ancien haut-allemand « blao » = brillant) est une des trois couleurs primaires. Sa longueur d'onde est comprise approximativement entre 446 et 520 nm. Elle varie en luminosité...). Ainsi, si deux parents ont les yeux bleus, ils ne possèdent tous les deux que des allèles 'yeux bleus' du gène 'couleur des yeux' et ils ne pourront avoir que des enfants aux yeux bleus.

Cependant le caractère étant codé sur plusieurs gènes distincts ( les gènes EYCL1, EYCL2 et EYCL3 sont les principaux gènes intervenant dans la couleur des yeux), il existe des cas rares où deux parents aux yeux bleus pourront donner naissance à un enfant aux yeux d'une autre couleur.

Méthode des groupes sanguins

Les groupes sanguins donnent aussi des indications sur la filiation. Une mère de groupe 'A' ne pourra avoir d'enfant de groupe 'AB' avec un père qui est également de groupe 'A' ou qui est de groupe 'O'.

Les caractères A et B des groupes sanguins d'un enfant doivent nécessairement avoir été hérités soit du père, soit de la mère car les gènes exprimant ces 2 caractères sont codominants. Un couple de groupe sanguin (Un groupe sanguin est une classification de sang reposant sur la présence ou l'absence de substances antigéniques héritées à la surface des globules rouges (hématies). Ces antigènes peuvent être des...) A et B peut avoir un enfant de groupe O. Le gène exprimant le groupe 'O', lui, est récessif : il ne s'exprimera qu'en l'absence des autres caractères.

Si le père et la mère sont de groupe A avec, dans les deux cas, un allèle 'A' et un allèle 'O', alors ils pourront avoir des enfants :

  • de groupe 'A' avec deux allèles 'A', ou
  • de groupe 'A' avec un allèle 'A' et un allèle 'O', ou
  • de groupe 'O' avec deux allèles 'O'.

De la même manière, le rhésus négatif est récessif. Il ne s'exprimera qu'en l'absence du caractère positif. Si les parents sont de rhésus négatif, ils ne pourront pas avoir d'enfant au rhésus positif.

  • Test de groupe sanguin

L'analyse ADN

Cette méthode, contrairement aux précédentes, requiert une analyse poussée de l'ADN de l'individu qui recherche (La recherche scientifique désigne en premier lieu l’ensemble des actions entreprises en vue de produire et de développer les connaissances...) ses parents ainsi que celui de son père et/ou de sa mère potentiels. Elle demande plusieurs jours (Le jour ou la journée est l'intervalle qui sépare le lever du coucher du Soleil ; c'est la période entre deux nuits, pendant laquelle les rayons du Soleil éclairent le ciel. Son début...) mais permet d'arriver à des réponses très tranchées : soit elle écartera la filiation, soit elle conclura à une très forte probabilité (La probabilité (du latin probabilitas) est une évaluation du caractère probable d'un évènement. En mathématiques, l'étude des probabilités est...) de filiation (supérieure à 99%).

Principe

Chaque individu possède dans ses chromosomes des portions d'ADN qui codent des gènes et d'autres (l'ADN « poubelle ») pour lesquelles aucune utilité n'a encore été découverte. Cette dernière partie possède une caractéristique intéressante : parmi elle, certaines séquences de paires de nucléotides s'enchaînent, répétées à l'identique. Ce sont les séquences répétées nommées minisatellites. La taille de ces minisatellites, correspondant au nombre (La notion de nombre en linguistique est traitée à l’article « Nombre grammatical ».) de répétitions de séquences ADN, est très variable (En mathématiques et en logique, une variable est représentée par un symbole. Elle est utilisée pour marquer un rôle dans une formule, un...) d'un individu à l'autre et peut aller de 5 à 50.

Cette taille est une caractéristique du chromosome (Le chromosome (du grec khroma, couleur et soma, corps, élément) est l'élément porteur de l'information génétique. Les chromosomes contiennent les gènes et permettent leur distribution égale dans les deux...). Elle s'hérite donc de la même manière que les allèles de celui-ci : parmi chaque paire (On dit qu'un ensemble E est une paire lorsqu'il est formé de deux éléments distincts a et b, et il s'écrit alors :) de chromosome d'un individu, il y en aura un qui correspondra aux caractéristiques du père et un autre à celles de la mère.

Le test de paternité (Un Test de paternité est une pratique scientifique basée sur l'analyse de l'ADN de deux personnes faite dans le but d'établir un lien de parenté génétique et, partant de là,...) consiste donc à évaluer la taille de certains minisatellites bien spécifiques. En comparant pour chaque chromosome, ces caractéristiques entre les chromosomes de l'enfant et ceux de ces parents potentiels, il est possible d'arriver à des conclusions : voir l'exemple ci-dessous.

Technique

Afin d'arriver à déterminer les tailles des minisatellites d'un individu, il faut effectuer une analyse approfondie de son ADN. Celui-ci est extrait d'un échantillon (De manière générale, un échantillon est une petite quantité d'une matière, d'information, ou d'une solution. Le mot est utilisé dans différents domaines :) prélevé sur l'individu (sang, salive (La salive est un liquide biologique sécrété par les glandes salivaires, à l'intérieur de la bouche.), etc.). L'ADN de chaque paire de chromosome est multiplié séparément par PCR (Réaction en chaîne par polymérase). Après cela, les brins sont découpés par une enzyme (Une enzyme est une molécule (protéine ou ARN dans le cas des ribozymes) permettant d'abaisser l'énergie d'activation d'une réaction et...) de restriction qui va isoler les minisatellites en préservant leur longueur (La longueur d’un objet est la distance entre ses deux extrémités les plus éloignées. Lorsque l’objet est filiforme ou en forme...). Ces morceaux d'ADN sont finalement analysés par électrophorèse : les molécules vont migrer et se regrouper en deux amas correspondant chacun à une taille différente (En mathématiques, la différente est définie en théorie algébrique des nombres pour mesurer l'éventuel défaut de dualité d'une application...) de minisatellites (issus des 2 chromosomes de la paire). Comme les molécules de grande taille sont les moins mobiles, la distance parcourue permet de déterminer la taille des minisatellites.

Cette même technique est utilisée pour déterminer l'empreinte génétique (Une empreinte génétique ou profil génétique est le résultat d'une analyse génétique, rendant possible l'identification d'une...) d'un individu.

Exemple

Voici les cartes génétiques de 4 personnes (Aurore, Bastien, Christine et Denis) et de l'enfant de 2 d'entre eux, Émilie. Dans chaque tableau (Tableau peut avoir plusieurs sens suivant le contexte employé :) est indiqué pour chaque chromosome, la taille du minisatellite ACGCC. Ainsi Aurore possède sur son premier chromosome 14 la séquence ACGCCACGCCACGCC (nb répétition=3) et sur son autre chromosome 14, la séquence ACGCCACGCCACGCCACGCC (nb répétition=4).

ADN d'Aurore
Chromosome analysé Taille du minisatellite
chromosome 1 8 et 15
chromosome 8 13 et 14
chromosome 13 4 et 15
chromosome 14 3 et 4
ADN de Christine
Chromosome analysé Taille du minisatellite
chromosome 1 2 et 8
chromosome 8 17 et 20
chromosome 13 4 et 4
chromosome 14 2 et 14
ADN de Bastien
Chromosome analysé Taille du minisatellite
chromosome 1 8 et 18
chromosome 8 5 et 7
chromosome 13 3 et 9
chromosome 14 2 et 8
ADN de Denis
Chromosome analysé Taille du minisatellite
chromosome 1 5 et 13
chromosome 8 5 et 5
chromosome 13 4 et 18
chromosome 14 3 et 8
ADN d'Émilie
Chromosome analysé Taille du minisatellite
chromosome 1 8 et 13
chromosome 8 5 et 17
chromosome 13 4 et 4
chromosome 14 2 et 3

En comparant les différents tableaux, on arrive à la conclusion que Christine et Denis sont les parents d'Émilie. En effet, d'après le chromosome 8, Aurore ne peut être la mère de l'enfant, car elle lui aurait transmis soit 13, soit 14 répétitions, or Émilie en possède 5 et 17. De la même manière, Bastien peut être écarté en se basant sur le chromosome 13 : il aurait nécessairement transmis une de ces répétitions. Les patrimoines de Christine et Denis permettent d'expliquer complètement (Le complètement ou complètement automatique, ou encore par anglicisme complétion ou autocomplétion, est une fonctionnalité...) les caractéristiques des chromosomes d'Émilie. Afin d'augmenter encore les probabilités de filiation, il faudrait comparer ces minisatellites sur davantage de chromosomes. Les laboratoires d'analyse parviennent à assurer des tests à l'issue desquels ils peuvent annoncer une probabilité de filiation excédant les 99%.

Exemples :

  • Après de nombreux rebondissements, ces examens ont permis de montrer qu'Aurore Drossard n'était pas la fille d'Yves Montand.
  • Albert II de Monaco a reconnu son fils Alexandre Coste suite à des analyses prouvant sa paternité.
  • Le cœur de Louis XVII a été authentifié grâce à des tests qui ont comparé son génome (Le génome est l'ensemble du matériel génétique d'un individu ou d'une espèce codé dans son ADN (à l'exception de...) à ceux de parentes de Marie-Antoinette.
Page générée en 0.207 seconde(s) - site hébergé chez Amen
Ce site fait l'objet d'une déclaration à la CNIL sous le numéro de dossier 1037632
Ce site est édité par Techno-Science.net - A propos - Informations légales
Partenaire: HD-Numérique